Répondre à la discussion
Affichage des résultats 1 à 9 sur 9

Séquence du promoteur du gène résistance à l'ampicilline



  1. #1
    lilou41

    Séquence du promoteur du gène résistance à l'ampicilline

    En cherchant sur Pubmed, on ne me donne que la séquence du gène de la résistance à l'ampicilline bla en commençant par le codon start ATG.
    J'aimerais savoir où trouver la séquence du promoteur de ce gène. C'est pour savoir si le site de restriction que j'ai choisi n'est pas trop près du promoteur.

    -----


  2. Publicité
  3. #2
    MaliciaR

    Re : Séquence du promoteur du gène résistance à l'ampicilline

    Salut,

    Ton gène est sous la dépendance de quel promoteur? Son propre promoteur (Pbla)? Si tu regardes la séquence de ton plasmide, tu risques d'y troruver quelques infos utiles


    Cordialement,
    An expert is one who knows more and more about less and less.

  4. #3
    IngDr

    Re : Séquence du promoteur du gène résistance à l'ampicilline

    Pourquoi veux tu cloner dans Bla ? Tu veux faire une protéine de fusion ? Utiliser le promoteur de Bla ?

    Cordialement,

    PS : un bonjour, et merci, pour la prochaine fois...
    PPS : ta question se rapportant à http://forums.futura-sciences.com/thread245455.html , tu aurais pu poursuivre sur le même fil

  5. #4
    lilou41

    Re : Séquence du promoteur du gène résistance à l'ampicilline

    J'ai la séquence complète du plasmide, mais je ne sais pas quelle est la séquence du promoteur bla (oui c'est celui-ci qui m'intéresse). Je sais juste où débute le codon start du gène bla.
    Je dois faire une restriction avec une enzyme et il ne faudrait pas que ça me coupe le promoteur. Je dois vérifier que l'enzyme est assez en amont du promoteur.

  6. #5
    piwi

    Re : Séquence du promoteur du gène résistance à l'ampicilline

    Je ne comprends pas trop le problème.
    Vous avez la séquence du plasmide. J'imagine que sur la carte vous devez avoir les limites de votre cassette ampi (promoteur et séquence codante). Y a qu'a compter pour trouver la séquence de votre promoteur sur votre plasmide.
    Vous passez ensuite ça à la moulinette de webcutter par exemple et vous savez quelles enzymes vous pourrez utiliser.

    Cordialement,
    piwi
    Je sers la science et c'est ma joie.... Il parait.

  7. A voir en vidéo sur Futura
  8. #6
    lilou41

    Re : Séquence du promoteur du gène résistance à l'ampicilline

    Justement le souci est que sur ma carte, je sais où est situé le début du gène bla, mais le promoteur n'est pas indiqué.

  9. Publicité
  10. #7
    piwi

    Re : Séquence du promoteur du gène résistance à l'ampicilline

    Vous pouvez voir avec une autre carte.
    Celle ci par exemple: http://www.addgene.org/pgvec1?f=d&cm...&vectorid=3768 (notez que la séquence du plasmide est linké en haut)

    La séquence du promoteur (bla-35 et bla-10) est ttcaaatatgtatccgctcatgagacaat

    C'est en forgeant que l'on devient forgeron mais il va falloir devenir plus débrouillard (je plaisante)

    Cordialement,
    piwi
    Je sers la science et c'est ma joie.... Il parait.

  11. #8
    lilou41

    Re : Séquence du promoteur du gène résistance à l'ampicilline

    Merci beaucoup

    Merci aussi pour le site! Je ne connais pas bien les sites où on peut chercher ce genre de chose désolée!

  12. #9
    piwi

    Re : Séquence du promoteur du gène résistance à l'ampicilline

    Je vous en prie. On est tous là à cherchouiller au début.
    Ce forum sert aussi à éviter aux nouveaux entrants dans les labos ou simplement les étudiants, à chercher les adresses utiles.

    Nous avons une bibliothèque de liens en tête de ce forum. Il me semble y avoir mis les sites dont je vous ai parlé. Vous y trouverez bien d'autres.

    Cordialement,
    piwi
    Je sers la science et c'est ma joie.... Il parait.

Sur le même thème :

Discussions similaires

  1. [Génétique] Elément régulateur du promoteur d'un géne
    Par julie29 dans le forum Biologie
    Réponses: 8
    Dernier message: 20/09/2009, 13h28
  2. [Biologie Cellulaire] Dominance gène p53, gène Rb
    Par ikki44 dans le forum Biologie
    Réponses: 3
    Dernier message: 06/05/2008, 19h53
  3. [Microbiologie] mode d'action de l'ampicilline et du formol?
    Par -Chani- dans le forum Biologie
    Réponses: 6
    Dernier message: 05/02/2008, 17h42
  4. [Biologie Moléculaire] changement de gene de resistance dans pCDNA3
    Par Exuperance dans le forum Biologie
    Réponses: 7
    Dernier message: 04/12/2007, 08h27
  5. Réponses: 3
    Dernier message: 30/06/2006, 11h42