Répondre à la discussion
Affichage des résultats 1 à 11 sur 11

exercie génétique



  1. #1
    bipbip44

    Lightbulb exercie génétique

    Bonour,
    J'ai un exercice sans correction, je vous le propose en espérant que quelqu'un pourra me dire si c'est juste ou non.

    Une molécule d'ADN bicaténaire possèdant la séquence :
    TAC ATG ATC TTA GGC AAT CGG TTC TAG CAT GTA
    ATG TAC TAG AAT CCG TTA GCC AAG ATC GTA CAT
    produit in vivo un polypeptide actif de 5 acides aminés.

    1: Dans quel brin se trouve le gène qui code pour ce polypeptide?
    2: Indiquez les extrémités 5' et 3' de chaque brin.
    3: Ecrivez la séquence de l'ARNm du gène.
    4: Ecrivez la séquence du peptide.


    J'ai tout d'abord cherché les extrémités 5' et 3' de chaque brin (je ne vois pas comment répondre à la première question sans cette indication) en m'aidant des codons stop. J'en ai déduit :

    3' TAC ATG ATC TTA GGC AAT CGG TTC TAG CAT GTA 5'
    5' ATG TAC TAG AAT CCG TTA GCC AAG ATC GTA CAT 3'

    (Si on prends les extrémités dans l'autre sens: les codons stop n'apparaissent pas au bon moment)
    Donc le gène codant pour le polypeptide est dans le brin 1.

    La séquence de l'ARNm est donc : 5' AUG UAC GAU CUU GGC 3' (Et là j'ai remarqué que il y a AUG en premier: est-ce que c'est toujours le cas?)

    Avec le tableau on en déduit la séquence en acides aminés:
    NH2-Met-Tyr-Asp-Leu-Gly-COOH

    merci de votre aide

    -----


  2. Publicité
  3. #2
    Yoyo

    Re : exercie génétique

    Salut

    En tout cas le raisonement est le bon. Maintenant par convention le brin superieur est toujours orienté 5'->3' si ca n'est pas le cas dans cet exo le prof est vraiment pas cool!

    donc
    5' TACATGATCTTAGGCAATCGGTTCTAGCAT GTA 3'
    en phase codante tu peu donc avoir:
    ATG ATC TTA GGC AAT CGG TTC TAG (c'est la seule commencnt par ATG)

    sur le brin complementaire (attention il est ecrit a l'envers):
    5' TACATGCTAGAACCGATTGCCTAAGATCAT GTA 3'
    ATG CTA GAA CCG ATT GCC TAA (la encore c'est le seul commencant par ATG)

    Et la se pose le probleme de la taille les deux sequences presentées ont respectivement 7 et 6 acides aminés, or l'exo parle de 5... Il est frequent que la methionine initiatrice soit clivée ce qui reduirait de 6 a 5 la taille du peptide mais c'est peut etre allé chercher un peu loin l'explication!

    Yoyo

  4. #3
    bipbip44

    Re : exercie génétique

    Si le raisonnement est bon, c'est l'essentiel. Merci.

  5. #4
    Effie

    Re : exercie génétique

    si on considère que les brins sont écrits de façon conventionnelle:
    5' TAC ATG ATC TTA GGC AAT CGG TTC TAG CAT GTA 3'
    3' ATG TAC TAG AAT CCG TTA GCC AAG ATC GTA CAT 5'

    L'ARN polymérase lit l'ADN de 3' vers 5', et le premier acide aminé incorporé est une méthionine (codon AUG):
    la transcription du brin du haut donne comme ARN (attention de lire l'ADN dans le bon sens, ici de droite à gauche):
    UAC AUG CUA GAA CCG AUU GCC UAA GAU....
    AUG est le codon initiateur; la méthionine sera éliminée (le texte précise que c'est le polypeptide actif, donc après maturation, qui comprend 5 acides aminés)
    UAA est un codon stop
    Il reste 5 codons entre les 2, donc 5 acides aminés.

  6. #5
    bipbip44

    Re : exercie génétique

    5' en haut à gauche et non à droite!! (dsl)

  7. A voir en vidéo sur Futura
  8. #6
    bipbip44

    Re : exercie génétique

    Je savais pas que actif voulais dire après maturation!
    Mais il y a plusieurs réponses ou alors la convention de 5' en haut à droite est toujours appliquée?

  9. Publicité
  10. #7
    bipbip44

    Re : exercie génétique

    ba ça alors, le message que je poste en premier apparait en deuxième !! bizarre

  11. #8
    Yoyo

    Re : exercie génétique

    Citation Envoyé par bipbip44 Voir le message
    Je savais pas que actif voulais dire après maturation!
    Mais il y a plusieurs réponses ou alors la convention de 5' en haut à droite est toujours appliquée?
    Il me semble que cette convention est universellement utilisée... en tout cas sur terre

    YOyo

  12. #9
    bipbip44

    Re : exercie génétique

    Bonjour, j'ai à nouveau un exercice où je dois numéroter les extrémités d'un ADN.

    Voici l'exercice: à cause d'une délétion un fragment d'ADN est double brin à chaque extrémité et simple brin en son milieu.
    soit: -----------P HO-----------
    -------------------------------

    J'aurais mis
    3'-----------P5' 3'HO-----------5'
    5'-------------------------------3'
    En commençant par 5'P et 3'OH. Est ce que dans un ADN on a toujours: 5'P et 3'OH ?
    Je pensais que oui (d'après la structure de l'ADN) mais d'après la convention, ça ne marche pas!

  13. #10
    Yoyo

    Re : exercie génétique

    Citation Envoyé par bipbip44 Voir le message
    En commençant par 5'P et 3'OH. Est ce que dans un ADN on a toujours: 5'P et 3'OH ?
    Je pensais que oui (d'après la structure de l'ADN) mais d'après la convention, ça ne marche pas!
    Oui naturellement l'ADN est 5'P et 3'OH maintenant tu peux obtenir des 5'OH par dephosphorylation

    La convention est a utilisée avec precaution, il n'est pas impossible que juste pour ne pas vous habituer le prof inverse de temps en temps les brins pour rendre l'exercice plus difficile. Par expl il est typique quand on demande de trouver un gene dans une sequence que ce gene se trouve sur le brin antiparallele, ca complexifie les choses

    YOyo

  14. #11
    bipbip44

    Re : exercie génétique

    tu peux obtenir des 5'OH par dephosphorylation
    Il faut quelles conditions pour obtenir une déphosphorylation?

Sur le même thème :

Discussions similaires

  1. exercie suivi cinétique gaz
    Par vic003 dans le forum Chimie
    Réponses: 0
    Dernier message: 06/10/2007, 12h16
  2. exercie : argent et fer
    Par sandalk dans le forum Chimie
    Réponses: 0
    Dernier message: 29/09/2007, 12h33
  3. exercie sur les sphères
    Par byeinstein dans le forum Mathématiques du collège et du lycée
    Réponses: 2
    Dernier message: 31/12/2006, 10h37
  4. Exercie chimie organique: alcools
    Par zakros dans le forum Chimie
    Réponses: 7
    Dernier message: 02/02/2006, 20h03
  5. [Biologie Moléculaire] Récepteurs NMDA
    Par ifnie dans le forum Biologie
    Réponses: 9
    Dernier message: 19/10/2003, 00h01