Répondre à la discussion
Affichage des résultats 1 à 8 sur 8

Problème de PCR



  1. #1
    leidjill

    Problème de PCR


    ------

    Bonjour à tous!!
    Je viens d'arriver sur le forum et la quantité d'information à disposition est vraiment impressionnante! J'ai toutefois une question concernant un problème de PCR. Le but de mes analyses est de pouvoir mesurer la taille d'un segment d'ADN en utilisant uniquement l'électrophorèse capillaire (ABI3130 xl). Mon segment d'ADN est constitué d'une suite de répétition de 6 bases. L'idée est d'utiliser une seule amorce (complémentaire à ma séquence répétitive) en espérant qu'elle se fixera au moins quelques fois au début du segment. Le profil que je m'attends à observer correspondrait à une série de pic avec le plus grand correspondant à la longueur de mon segment d'ADN

    Ma première question est donc la suivante : pensez vous que techniquement ce soit réalisable ou voyez vous certains problèmes auxquels je n'ai pas pensé?

    Si je vous ai posé cette question c'est que j'ai déjà fait des tests et que pratiquement ça n'a pas l'air de fonctionner: mon amorce fait 24bp, mon segment 120 bp et tout ce que j'observe c'est un seul pic aux alentours des 50 bp. Avez vous une explication?

    Je vous remercie d'avance pour vos réponses

    -----

  2. Publicité
  3. #2
    jmbowie

    Re : problème de PCR

    Citation Envoyé par leidjill Voir le message
    Bonjour à tous!!
    Je viens d'arriver sur le forum et la quantité d'information à disposition est vraiment impressionnante! J'ai toutefois une question concernant un problème de PCR. Le but de mes analyses est de pouvoir mesurer la taille d'un segment d'ADN en utilisant uniquement l'électrophorèse capillaire (ABI3130 xl). Mon segment d'ADN est constitué d'une suite de répétition de 6 bases. L'idée est d'utiliser une seule amorce (complémentaire à ma séquence répétitive) en espérant qu'elle se fixera au moins quelques fois au début du segment. Le profil que je m'attends à observer correspondrait à une série de pic avec le plus grand correspondant à la longueur de mon segment d'ADN

    Ma première question est donc la suivante : pensez vous que techniquement ce soit réalisable ou voyez vous certains problèmes auxquels je n'ai pas pensé?

    Si je vous ai posé cette question c'est que j'ai déjà fait des tests et que pratiquement ça n'a pas l'air de fonctionner: mon amorce fait 24bp, mon segment 120 bp et tout ce que j'observe c'est un seul pic aux alentours des 50 bp. Avez vous une explication?

    Je vous remercie d'avance pour vos réponses
    Et bien si tu mets une polymérase, elle va catalyser l'extension de ton amorce et les produits que tu vas obtenir seront forcément plus grand que la taille de ton premier site. Mais je comprend pas un truc: c'est une amplification ou bien juste une extension d'amorce (comme en séquencage) ?
    Blast up your life!

  4. #3
    leidjill

    problème de PCR

    Ce que j'aimerais c'est que l'amorce se fixe au début de mon fragment et qu'il y ait suffisamment de copies pour pouvoir voir un pic à 120bp (taille de mon fragment de contrôle) sur le 3130xl. Ce que je m'attendais à voir c'est toute une série de pics qui se suivent avec le plus grand qui devrait normalement représenter la taille de mon segment...Cependant je n'ai aucune idée sur les préférences de fixation d'une amorce: étant donnée qu'elle pourrait se fixer n'importe où sur mon segment est ce qu'il y a une chance qu'elle se fixe au début?

    Ex de séquence de mon amorce : TTAGGGTTAGGGTTAGGGTTAGGG
    Ex de séquence de mon segment de contrôle : AATCCCAATCCCAATCCCAATCCCAATCCC AATCCCAATCCC.... au total 20 répétitions de AATCCC

    J'espère que tu vois un peu mieux mon problème

  5. #4
    Florian Galilée

    Re : problème de PCR

    Avec une sécance aussi répétitive, il doit y avoir à mon avis une amplification aléatoire tout au début de la PCR, mais aprés chaque amplifications, les bouts emplifiers étant similaires, l'ADN vas se recombiner de telle sorte que seul la moitié de l'ADN va être emplifier en fin de PCR (la moitié parceque c'est le plus probable, c'est toujours des probas, mais n'étant pas mathématicien, ma remarque peut préter à être critiquée).

    Je suis conscient de ne pas être clair, cependant, vu la sécance, je pense que c'est pas trés facile comme manip, et que seul un hasart trés fort pourrais faire emplifier l'ADN entier.

    Je n'ai jamais essayer. Je réfléchi pour faire avancer le schmilblic.

  6. #5
    Burt67

    Re : Problème de PCR

    Je ne suis pas spécialiste, ma remarque est peut-être décalée, mais si tu fais une simple migration sur gel avec un peu de BET et plusieurs marqueurs, cela te permettrait peut-être d'avoir une idée de l'efficacité de ta PCR ?

  7. A voir en vidéo sur Futura
  8. #6
    leidjill

    Re : problème de PCR

    Citation Envoyé par Florian Galilée Voir le message
    Avec une sécance aussi répétitive, il doit y avoir à mon avis une amplification aléatoire tout au début de la PCR, mais aprés chaque amplifications, les bouts emplifiers étant similaires, l'ADN vas se recombiner de telle sorte que seul la moitié de l'ADN va être emplifier en fin de PCR (la moitié parceque c'est le plus probable, c'est toujours des probas, mais n'étant pas mathématicien, ma remarque peut préter à être critiquée).

    Je suis conscient de ne pas être clair, cependant, vu la sécance, je pense que c'est pas trés facile comme manip, et que seul un hasart trés fort pourrais faire emplifier l'ADN entier.

    Je n'ai jamais essayer. Je réfléchi pour faire avancer le schmilblic.
    Salut!
    Merci pour ta réponse
    Pourrais tu m'expliquer pourquoi l'ADN se recombine? (et ce que cela signifie) Je pense effectivement qu'il faudra beaucoup de chance pour que l'amorce se fixe quelques fois au début du segment mais sais tu pourquoi il y aurait plus de chance qu'elle se fixe au milieu du segment plutôt qu'au début?

    Merci encore

  9. Publicité
  10. #7
    Florian Galilée

    Re : Problème de PCR

    Bonjour,

    La nuit porte conseil...

    Même si l'amorce, par chance, se fixe une fois au début du brin d'ADN. Ce n'est pas assez pour qu'il soit amplifier. Il faudrait qu'il le soit à chaque fois sur tes 40 cycles (c'est un exemple le nombre de cycle), pour que tu le détecte.

    Je crois que j'ai compris ce qu'il se passe dans ton tube.

    On oublis les histoire de probabilités avec le milieu du brin d'ADN du message d'hier.

    Lors de tes premiers cycles d'amplifications, il doit y avoir l'amorce qui se fixe sur les nombreuse sites possibles. Sachant que la probabilitée de se mettre en début du brin comme tu le souhaite est 1 sur 15.
    Aprés les premières amplifications, les brins d'ADN se sépare pret à fixer de nouvelles amorce. Sachant que 14 sur 15 de ces brins ne sont pas le plus long. L'amorce vas alors se fixer au hazart, avec tout autant de chanse de se fixer au début (ça veut dire peut). Ainsi de suite, les brins amplifier vont être de plus en plus courts, et les premiers brins amplifiés en début de PCR ne vont pas être assez nombreux pour être détectés.

    En fin de PCR, tu obtiendra tout simplement, le brin d'ADN amplifiable le plus court possible. C'est ce qui doit correspondre à tes 50 paires de bases, soit une longueur de 2 amorces.

    Voilà la possibilitée que j'ai à te proposer.

    Je n'ai pas la prétention de détenir la véritée, en espérant que tu arrive à ton but, mais avec un brin d'ADN aussi répétitif, ce n'est pas simple.

  11. #8
    Zellus

    Re : Problème de PCR

    Bonsoir,

    Est-ce que tu pourrais nous donner ton protocole s'il te plaît (cycles, concentrations d'amorce et de matrice ...). Je ne sais pas pour les autres, mais personnellement j'y verrai un peu plus clair ...
    Merci !!

    Cordialement,
    Zellus

Sur le même thème :

Discussions similaires

  1. [Biologie Moléculaire] Problème PCR : Besoin d'aide
    Par ValHab dans le forum Biologie
    Réponses: 9
    Dernier message: 17/02/2014, 12h17
  2. [Biologie Moléculaire] PCR en temps réel ou Q-PCR
    Par belouga7 dans le forum Biologie
    Réponses: 4
    Dernier message: 22/10/2008, 19h09
  3. [Biologie Moléculaire] Pcr
    Par mia12 dans le forum Biologie
    Réponses: 4
    Dernier message: 28/04/2008, 21h10
  4. Problème RT-PCR sur cDNA
    Par xavierdaniel85 dans le forum Biologie
    Réponses: 6
    Dernier message: 26/04/2006, 11h30
  5. Pcr
    Par Nicolas r dans le forum Biologie
    Réponses: 3
    Dernier message: 18/04/2006, 21h45