Répondre à la discussion
Affichage des résultats 1 à 2 sur 2

design des amorces



  1. #1
    mkh

    design des amorces


    ------

    bonsoir,
    si on considère la séquence d'ADN SUIVANTE par exemple 5' [ATGGGCCCATGA ]TGCCGTCAGTAGGTCCCAGGTCGAATGCGC TGTCAC 3' on se propose de désigner l'amorce correspondante à la séquence entre crochets pour effectuer une amplification de l'ADN ça sera 5' TCATGGGCCCAT 3' j'aimerais bien savoir combien de codons je dois prendre en considération pour designer l'amorce je m'arrête là ou je continue après les crochets.
    merci
    cordialement,
    MKH

    -----

  2. #2
    Guillaume69

    Re : design des amorces

    Salut,

    Il s'agit d'une amplification par PCR, donc d'une réplication de l'ADN. Les codons (= unité de lecture des ribosomes lors de la traduction) n'interviennent donc pas ici.
    De plus, d'après le principe de fonctionnement de la PCR (qui repose sur l'utilisation in vitro d'une polymérase), il ne faut pas une mais deux amorces (une forward en 5' et une reverse en 3') pour que l'amplification ait lieu.

    Le choix des primers est fait selon, pour simplifier, deux gros paramètres :
    Le Tm (température d'hybridation des primers)
    La spécificité des primers pour la séquence donnée (il ne faut pas qu'ils se fixent sur une autre séquence).

    Donc pour tout cela, il y a des logiciels. Mais là comme il s'agit visiblement d'un exercice théorique, je ne vois pas trop quoi te répondre pour te dire où t'arrêter ...

Discussions similaires

  1. [Biologie Moléculaire] reconstitution et dilution des amorces
    Par meriama6 dans le forum Biologie
    Réponses: 14
    Dernier message: 11/08/2015, 17h02
  2. Question sur le fonctionnement des amorces en PCR
    Par lwarlee dans le forum Biologie
    Réponses: 5
    Dernier message: 19/01/2012, 15h48
  3. [Biologie Moléculaire] Tm mystère des amorces PCR
    Par Laeti06 dans le forum Biologie
    Réponses: 9
    Dernier message: 14/06/2011, 17h01
  4. [Biologie Moléculaire] choix des amorces
    Par OULD HAMOUDA dans le forum Biologie
    Réponses: 3
    Dernier message: 07/04/2011, 15h58
  5. [Biologie Moléculaire] Choix des amorces de la PCR
    Par hollsiwasam dans le forum Biologie
    Réponses: 5
    Dernier message: 18/01/2010, 09h02