Répondre à la discussion
Affichage des résultats 1 à 18 sur 18

Bio informatique




  1. #1
    Azaaar

    Exclamation Bio informatique

    Bonsoir,

    J'ai un exercice de Bioinformatique je dois utilisé BLAST mais j'ai du mal à trouvé a quoi correspond cette séquence de nucléotide vous pourriez m'aidé, me donner un chemin à suivre, un indice...


    Un client vous a donné un fragment d'os découvert dans son jardin du sud de la France, vous avez prélevé un peu d'ADN et obtenu la séquence suivante : de quoi s'agit-il ?

    tcatacatcaactacaactccaaagacacc

    A quel organisme appartient cette séquence, quel genre, quelle espèce, à quel chromosome, à quel gène et que code t-elle ?

    -----


  2. Publicité
  3. #2
    minushabens

    Re : Bio informatique

    qu'est-ce que tu n'arrives pas à faire?

  4. #3
    Alhec

    Re : Bio informatique

    Hé ben c'est où que tu coinces?
    En tout cas moi j'ai trouvé la réponse
    Dernière modification par Alhec ; 15/09/2018 à 11h24.


  5. #4
    Flyingbike

    Re : Bio informatique

    oui, il n'y a pas de piège
    La vie trouve toujours un chemin

  6. #5
    Azaaar

    Re : Bio informatique

    Bonjour,

    Je suis débutant, c'est mon premier pas en bio informatique, je suis entrain de découvrir cette UE, alors pour moi c'est pas si évident et si facile que sa.

    Si ça ne vous dérange pas je vous montre pas pièce jointe ce que je trouve lors de ma manipulation sur BLAST sauf que mon résultat ne répond pas à la question posé. Du moins je trouve qu'il y a un problème a moins que sa soit moi qui cherche trop loin.

    Capture d’écran 2018-09-15 à 09.33.55.png Capture d’écran 2018-09-15 à 09.35.25.png Capture d’écran 2018-09-15 à 09.35.47.png

  7. A voir en vidéo sur Futura
  8. #6
    Flyingbike

    Re : Bio informatique

    En quoi ça ne répond pas à la question ?
    Votre fragment correspond parfaitement aux séquences données en résultat
    Vous pouvez donc dire à qui elle appartient et sur quel chromosome elle se trouve déjà.

    Ensuite pour le gène on verra
    La vie trouve toujours un chemin

  9. #7
    Azaaar

    Re : Bio informatique

    Organisme : Homo sapiens neanderthalensis

    Qu'est ce qu'on entends par "genre" et "espèce" ? Pour le genre il faut que je mette le numéro "Taxonomy" ? Et pour l'espèce je mets primates ?

    J'avoue être un peu perdu là...

    Pour le chromosome ça fait 2h00 que je clique un peu partout j'essaie de découvrir chaque lien mais je ne trouve strictement rien, pareil pour le gène on me donne plein de gène et code.

    Je suis désespéré...

    Capture d’écran 2018-09-15 à 15.05.23.pngCapture d’écran 2018-09-15 à 15.05.37.png

  10. Publicité
  11. #8
    Azaaar

    Re : Bio informatique

    Je viens d'y pensé, le Chromosome c'est du Chromosome mitochondrial puis ce qu'on est dans le génome mitochondrial (ADN circulaire) c'est ça ?

  12. #9
    minushabens

    Re : Bio informatique

    Citation Envoyé par Azaaar Voir le message
    Organisme : Homo sapiens neanderthalensis

    Qu'est ce qu'on entends par "genre" et "espèce" ? Pour le genre il faut que je mette le numéro "Taxonomy" ? Et pour l'espèce je mets primates ?
    ah oui, on part de loin là... Tu devrais savoir que le genre d'Homo sapiens est Homo et le nom d'espèce sapiens. Neanderthalensis est vu ici comme le nom d'une sous-espèce.

  13. #10
    Flyingbike

    Re : Bio informatique

    Citation Envoyé par Azaaar Voir le message
    Je viens d'y pensé, le Chromosome c'est du Chromosome mitochondrial puis ce qu'on est dans le génome mitochondrial (ADN circulaire) c'est ça ?
    Oui !
    La vie trouve toujours un chemin

  14. #11
    Azaaar

    Re : Bio informatique

    Donc du coup si je résume mes recherches et l'aide que vous m'avez apporter ma réponse à la question de l'exercice de bio informatique serait :

    Organisme : Homo sapiens neanderthalensis

    Espèce : Sapiens

    Sous-espèce : Neanderthalensis

    Chromosome : Mitochondrial

    Mon réel problème c'est au niveau du gène comment je peux faire pour le trouver et ce qu'il code s'il vous plait un indice ?

  15. #12
    minushabens

    Re : Bio informatique

    La colonne de droite dans les résultats de Blast contient l' "accession number" de la séquence dans la base de données qui est la plus proche de ta séquence. Si tu cliques sur ce nombre tu obtiendras une description détaillée de cette séquence.

  16. #13
    Flyingbike

    Re : Bio informatique

    La colonne de droite dans les résultats de Blast contient l' "accession number" de la séquence dans la base de données qui est la plus proche de ta séquence. Si tu cliques sur ce nombre tu obtiendras une description détaillée de cette séquence.
    si tu fais ça, tu as accès a la séquence entière dans laquelle a été retrouvée ton fragment. si c'est du génomique, difficile d'y voir clair (https://www.ncbi.nlm.nih.gov/nucleotide/MG025536.1?report=genbank&log$ =nucltop&blast_rank=1&RID=TVVN JR5B014)

    tu peux aller tout en bas dans Alignements et cliquer sur "graphics"
    Capture d’écran 2018-09-16 à 07.51.00.png


    on obtient ca
    Capture d’écran 2018-09-16 à 07.51.45.jpg
    entouré en rouge la région ou se trouve la requete

    en vert ce sont les gènes a proximité
    Dernière modification par Flyingbike ; 16/09/2018 à 07h57.
    La vie trouve toujours un chemin

  17. #14
    Azaaar

    Re : Bio informatique

    Merci de votre aide mais je comprends toujours pas... En faite tous ce que vous m'avez montrer je l'ai déjà fait mais il y a tellement d'information que je n'arrive pas a en retirer c'elle dont j'ai besoin qui est le gène et que code t'il, j'ai vraiment du mal c'est vraiment infernale.

  18. #15
    Azaaar

    Re : Bio informatique

    Là où elle se trouve elle ne code pour rien j'ai l'impression ... car dans le marqueur il n'y a aucun nom de protéine

  19. #16
    Flyingbike

    Re : Bio informatique

    Citation Envoyé par minushabens Voir le message
    La colonne de droite dans les résultats de Blast contient l' "accession number" de la séquence dans la base de données qui est la plus proche de ta séquence. Si tu cliques sur ce nombre tu obtiendras une description détaillée de cette séquence.
    oui, la séquence est dans de l'ADN non codant, visiblement
    La vie trouve toujours un chemin

  20. #17
    Azaaar

    Re : Bio informatique

    Ah on est bien d'accord donc elle ne code pour aucune protéine... mais du coup ce gène porte qu'elle nom ?

  21. #18
    Flyingbike

    Re : Bio informatique

    ben du coup, il n'a pas de nom
    La vie trouve toujours un chemin

Discussions similaires

  1. Intégrer une licence 2 informatique après un DUT Informatique
    Par mty60 dans le forum Orientation après le BAC
    Réponses: 4
    Dernier message: 26/08/2015, 14h45
  2. Réponses: 4
    Dernier message: 28/02/2014, 16h42
  3. L3 mathématiques-informatique ,en poche refus d'inscription en L3 informatique?
    Par dalida1111 dans le forum Mathématiques du supérieur
    Réponses: 6
    Dernier message: 25/10/2013, 11h59
  4. Réponses: 2
    Dernier message: 10/04/2013, 20h31
  5. puces informatique ,broquante informatique ? ,vide grenier ...
    Par Tix dans le forum Matériel - Hardware
    Réponses: 7
    Dernier message: 10/07/2006, 10h41